Discovery and characterization of two highly divergent variants of a novel potyvirus species infecting Madagascar periwinkle (Catharanthus roseus L.).

During summer 2022, a cluster of Madagascar periwinkle plants with white and mauve flowers were observed with foliar mild yellow mosaic symptoms on a private property in Harlingen, Cameron County, Texas. The symptoms were reproduced on mechanically inoculated periwinkle and Nicotiana benthamiana plants. Virions of 776 to 849 nm in length and 11.7 to 14.8 nm in width were observed in transmission electron microscopy of leaf dip preparations made from symptomatic periwinkle leaves. Highthroughput sequencing (HTS) analysis of total RNA extracts from symptomatic leaves revealed the occurrence of two highly divergent variants of a novel Potyvirus species as the only virus-like sequences present in the sample. The complete genomes of both variants were independently amplified via RT-PCR, cloned, and Sanger sequenced. The 5' and 3' of the genomes were acquired using RACE methodology. The assembled virus genomes were 9,936 and 9,944 nucleotides (nt) long and they shared 99.9-100% identities with the respective HTS-derived genomes. Each genome encoded hypothetical polyprotein of 3,171 amino acids (aa) (362.6 kDa) and 3,173 aa (362.7 kDa), respectively, and they shared 77.3%/84.4% nt/aa polyproteins identities, indicating that they represent highly divergent variants of the same Potyvirus species. Both genomes also shared below species threshold polyprotein identity levels with the most closely phylogenetically related known potyviruses thus indicating that they belong to a novel species. The name periwinkle mild yellow mosaic virus (PwMYMV) is given to the potyvirus with complete genomes of 9,936 nt for variant 1 (PwMYMV-1) and 9,944 nt for variant 2 (PwMYMV-2). We propose that PwMYMV be assigned into the genus Potyvirus (family Potyviridae).

Identification of yam mosaic virus as the main cause of yam mosaic diseases in Ethiopia.

Yam (Dioscorea spp.) is a staple food crop with cultural, nutritional and economic significance for millions of small-scale farmers in sub-Saharan Africa. While various virus-like symptoms such as mosaic and chlorosis are frequently observed in yam fields in Ethiopia, little information is available on the prevalence, distribution, and molecular characteristics of viruses causing these symptoms. The aim of this study was to investigate the incidence and distribution of yam viruses and determine the primary cause of yam mosaic diseases (YMD) in Ethiopia. Both symptomatic (n = 280) and asymptomatic (n = 110) yam leaf samples were collected and tested for potyviruses using ACP-ELISA. In addition, the symptomatic leaf samples were screened for yam mosaic virus (YMV), yam mild mosaic virus (YMMV), and cucumber mosaic virus (CMV) by DAS-ELISA. Subsequently, total RNA was extracted from 130 leaf samples comprising 94 symptomatic and 36 asymptomatic samples representing the different study areas. The representative RT-PCR amplicons (n = 6) were Sanger sequenced. The ACP-ELISA and DAS-ELISA results showed 9.2%, and 12.9% YMV infection, respectively, while the RT-PCR analysis showed 28.5% YMV positivity rate. Both CMV and YMMV were not detected in any of the samples tested. Thus, YMV is confirmed as the primary cause of YMD in Ethiopia. YMV isolates from Ethiopia shared 92-93% nucleotide identity among themselves and 85-99% with other YMV isolates from the GenBank. Phylogenetic analysis revealed that YMV isolates from Ethiopia, South America, and west-central Africa have the most recent common ancestor, while isolates from China and Japan are clustered as sister groups. This study enhances our understanding of YMV's genetic diversity and provides valuable information regarding the first report of YMV in Ethiopia.

First Report of Sugarcane Mosaic Virus Infecting Goose Grass in Shandong Province, China.

Sugarcane mosaic virus (SCMV genus Potyvirus, family Potyviridae) can infect maize, sugarcane, sorghum, other graminaceous crops, and some weed species (Alegria et al., 2003; Achon et al., 2007). In August 2023, the leaves of goose grass (Eleusine indica) plants surrounding maize fields in a village of Liaocheng City, Shandong Province, China showed mosaic and chlorotic symptoms (26%, 11 of 43 grasses; Figure S1). Three symptomatic goose grass samples were selected and pooled for total RNA isolation using TRIzol reagent (Tiangen, Beijing, China). A small RNA library was created using 2.0 µg of total RNA and the mirVana miRNA Isolation Kit, followed by size selection (18-28 nt), adapter ligation, purification, reverse transcription (RT), and polymerase chain reaction (PCR) enrichment. High-throughput sequencing (HTS) was then performed on a HiSeq 2500 platform (Illumina, San Diego, CA, USA). The adapter sequences were removed and the reads were assembled de novo into larger contigs using ABySS software v. 1.9.0 with a k-mer of 32. Fifty-one contigs were obtained after the reads were spliced and screened (alignment length > 30 bp; e-value ≤ 0.05). The contigs were compared with viral sequences in GenBank using local BLASTn. Thirty-four contigs (34-64 nt) had the highest identities (97.18-100%) with the SCMV genome sequence, covering approximately 12.8% of the SCMV genome (Table S1). The low coverage of small contigs mapping to the SCMV genome in the HTS results may be attributed to variations in sequencing depth and sample preparation quality, biological aspects of the virus affecting siRNA production and detection, as well as the variability in viral genome and its size (Golyaev et al., 2019; Valenzuela et al., 2022). The other 17 contigs did not align to any plant virus sequences, but aligned to plant sequences, including Phragmites australis and Panicum virgatum. Potyvirus-degenerated primers PotyF (5'-ATGGTHTGGTGYATHGARAAYGG-3') and PotyR (5'-TGCTGCKGCYTTCATYTG-3') (Marie-Jeanne et al. 2000) were used in RT-PCR to detect SCMV in symptomatic leaves, yielding a ~300 bp amplicon. Sanger sequencing and BLASTn analysis confirmed the 97.98% nucleotide identity with SCMV isolate BJ (GenBank accession No. AY042184.1). The sequence was deposited in GenBank under accession number OR777055. In addition, specific SCMV primers SCMV-F (5'- TCCGGAACTGTGGATGCA-3') and SCMV-R (5'- GTGGTGCTGCTGCACTCCC-3') (coat protein region, 939 bp) detected the virus in all 11 symptomatic goose grass leaves, with no detection in asymptomatic leaves. Inoculation tests using extracts from symptomatic goose grass on maize plants resulted in mosaic symptoms (7 of 15 plants) at 4-6 days post-inoculation (Figure S2 and 3). However, no symptoms were observed in maize plants following inoculation with leaf extracts from healthy goose grass. RT-PCR confirmed the presence of SCMV in the diseased maize plants. Sequencing analysis revealed that all amplified fragments shared 100% identity with the partial CP-encoding sequence of SCMV. Taken together these results support the presence of SCMV in symptomatic goose grass. To the best of our knowledge, this is the first report of SCMV in E. indica in China. In general, potyviruses can be easily transmitted in multiple ways including aphid vectors, grafting, and wounding. Therefore, investigating SCMV in goose grass is crucial for developing integrated strategies to prevent its transmission to economically important plants such as maize.

Identification of epigenetically regulated genes involved in plant-virus interaction and their role in virus-triggered induced resistance.

BACKGROUND: Plant responses to a wide range of stresses are known to be regulated by epigenetic mechanisms. Pathogen-related investigations, particularly against RNA viruses, are however scarce. It has been demonstrated that Arabidopsis thaliana plants defective in some members of the RNA-directed DNA methylation (RdDM) or histone modification pathways presented differential susceptibility to the turnip mosaic virus. In order to identify genes directly targeted by the RdDM-related RNA Polymerase V (POLV) complex and the histone demethylase protein JUMONJI14 (JMJ14) during infection, the transcriptomes of infected mutant and control plants were obtained and integrated with available chromatin occupancy data for various epigenetic proteins and marks. RESULTS: A comprehensive list of virus-responsive gene candidates to be regulated by the two proteins was obtained. Twelve genes were selected for further characterization, confirming their dynamic regulation during the course of infection. Several epigenetic marks on their promoter sequences were found using in silico data, raising confidence that the identified genes are actually regulated by epigenetic mechanisms. The altered expression of six of these genes in mutants of the methyltransferase gene CURLY LEAF and the histone deacetylase gene HISTONE DEACETYLASE 19 suggests that some virus-responsive genes may be regulated by multiple coordinated epigenetic complexes. A temporally separated multiple plant virus infection experiment in which plants were transiently infected with one virus and then infected by a second one was designed to investigate the possible roles of the identified POLV- and JMJ14-regulated genes in wild-type (WT) plants. Plants that had previously been stimulated with viruses were found to be more resistant to subsequent virus challenge than control plants. Several POLV- and JMJ14-regulated genes were found to be regulated in virus induced resistance in WT plants, with some of them poisoned to be expressed in early infection stages. CONCLUSIONS: A set of confident candidate genes directly regulated by the POLV and JMJ14 proteins during virus infection was identified, with indications that some of them may be regulated by multiple epigenetic modules. A subset of these genes may also play a role in the tolerance of WT plants to repeated, intermittent virus infections.

Effects of Maize Chlorotic Mottle Virus and Potyvirus Resistance on Maize Lethal Necrosis Disease.

Maize lethal necrosis (MLN) is a viral disease caused by host co-infection by maize chlorotic mottle virus (MCMV) and a potyvirus, such as sugarcane mosaic virus (SCMV). The disease is most effectively managed by growing MLN-resistant varieties. However, the relative importance of MCMV and potyvirus resistance in managing this synergistic disease is poorly characterized. In this study, we evaluated the effects of SCMV and/or MCMV resistance on disease, virus titers, and synergism and explored expression patterns of known potyvirus resistance genes TrxH and ABP1. MLN disease was significantly lower in both the MCMV-resistant and SCMV-resistant inbred lines compared with the susceptible control Oh28. Prior to 14 days postinoculation (dpi), MCMV titers in resistant lines N211 and KS23-6 were more than 100,000-fold lower than found in the susceptible Oh28. However, despite no visible symptoms, titer differences between MCMV-resistant and -susceptible lines were negligible by 14 dpi. In contrast, systemic SCMV titers in the potyvirus-resistant line, Pa405, ranged from 130,000-fold to 2 million-fold lower than susceptible Oh28 as disease progressed. Initial TrxH expression was up to 49,000-fold lower in Oh28 compared with other genotypes, whereas expression of ABP1 was up to 4.5-fold lower. Measures of virus synergy indicate that whereas MCMV resistance is effective in early infection, strong potyvirus resistance is critical for reducing synergist effects of co-infection on MCMV titer. These results emphasize the importance of both potyvirus resistance and MCMV resistance in an effective breeding program for MLN management.

Turnip mosaic virus NIb weakens the function of eukaryotic translation initiation factor 6 facilitating viral infection in Nicotiana benthamiana.

Viruses rely completely on host translational machinery to produce the proteins encoded by their genes. Controlling translation initiation is important for gaining translational advantage in conflicts between the host and virus. The eukaryotic translation initiation factor 4E (eIF4E) has been reported to be hijacked by potyviruses for virus multiplication. The role of translation regulation in defence and anti-defence between plants and viruses is not well understood. We report that the transcript level of eIF6 was markedly increased in turnip mosaic virus (TuMV)-infected Nicotiana benthamiana. TuMV infection was impaired by overexpression of N. benthamiana eIF6 (NbeIF6) either transiently expressed in leaves or stably expressed in transgenic plants. Polysome profile assays showed that overexpression of NbeIF6 caused the accumulation of 40S and 60S ribosomal subunits, the reduction of polysomes, and also compromised TuMV UTR-mediated translation, indicating a defence role for upregulated NbeIF6 during TuMV infection. However, the polysome profile in TuMV-infected leaves was not identical to that in leaves overexpressing NbeIF6. Further analysis showed that TuMV NIb protein, the RNA-dependent RNA polymerase, interacted with NbeIF6 and interfered with its effect on the ribosomal subunits, suggesting that NIb might have a counterdefence role. The results propose a possible regulatory mechanism at the translation level during plant-virus interaction.

A natural substitution of a conserved amino acid in eIF4E confers resistance against multiple potyviruses.

Eukaryotic translation initiation factor 4E (eIF4E), which plays a pivotal role in initiating translation in eukaryotic organisms, is often hijacked by the viral genome-linked protein to facilitate the infection of potyviruses. In this study, we found that the naturally occurring amino acid substitution D71G in eIF4E is widely present in potyvirus-resistant watermelon accessions and disrupts the interaction between watermelon eIF4E and viral genome-linked protein of papaya ringspot virus-watermelon strain, zucchini yellow mosaic virus or watermelon mosaic virus. Multiple sequence alignment and protein modelling showed that the amino acid residue D71 located in the cap-binding pocket of eIF4E is strictly conserved in many plant species. The mutation D71G in watermelon eIF4E conferred resistance against papaya ringspot virus-watermelon strain and zucchini yellow mosaic virus, and the equivalent mutation D55G in tobacco eIF4E conferred resistance to potato virus Y. Therefore, our finding provides a potential precise target for breeding plants resistant to multiple potyviruses.

Genetic basis of Arabidopsis thaliana responses to infection by naïve and adapted isolates of turnip mosaic virus.

Plant viruses account for enormous agricultural losses worldwide, and the most effective way to combat them is to identify genetic material conferring plant resistance to these pathogens. Aiming to identify genetic associations with responses to infection, we screened a large panel of Arabidopsis thaliana natural inbred lines for four disease-related traits caused by infection by A. thaliana-naïve and -adapted isolates of the natural pathogen turnip mosaic virus (TuMV). We detected a strong, replicable association in a 1.5 Mb region on chromosome 2 with a 10-fold increase in relative risk of systemic necrosis. The region contains several plausible causal genes as well as abundant structural variation, including an insertion of a Copia transposon into a Toll/interleukin receptor (TIR-NBS-LRR) coding for a gene involved in defense, that could be either a driver or a consequence of the disease-resistance locus. When inoculated with TuMV, loss-of-function mutant plants of this gene exhibited different symptoms than wild-type plants. The direction and severity of symptom differences depended on the adaptation history of the virus. This increase in symptom severity was specific for infections with the adapted isolate. Necrosis-associated alleles are found worldwide, and their distribution is consistent with a trade-off between resistance during viral outbreaks and a cost of resistance otherwise, leading to negative frequency-dependent selection.

Mixed infection of ITPase-encoding potyvirid and secovirid in Mercurialis perennis: evidences for a convergent euphorbia-specific viral counterstrike.

BACKGROUND: In cellular organisms, inosine triphosphate pyrophosphatases (ITPases) prevent the incorporation of mutagenic deaminated purines into nucleic acids. These enzymes have also been detected in the genomes of several plant RNA viruses infecting two euphorbia species. In particular, two ipomoviruses produce replicase-associated ITPases to cope with high concentration of non-canonical nucleotides found in cassava tissues. METHOD: Using high-throughput RNA sequencing on the wild euphorbia species Mercurialis perennis, two new members of the families Potyviridae and Secoviridae were identified. Both viruses encode for a putative ITPase, and were found in mixed infection with a new partitivirid. Following biological and genomic characterization of these viruses, the origin and function of the phytoviral ITPases were investigated. RESULTS: While the potyvirid was shown to be pathogenic, the secovirid and partitivirid could not be transmitted. The secovirid was found belonging to a proposed new Comovirinae genus tentatively named "Mercomovirus", which also accommodates other viruses identified through transcriptome mining, and for which an asymptomatic pollen-associated lifestyle is suspected. Homology and phylogenetic analyses inferred that the ITPases encoded by the potyvirid and secovirid were likely acquired through independent horizontal gene transfer events, forming lineages distinct from the enzymes found in cassava ipomoviruses. Possible origins from cellular organisms are discussed for these proteins. In parallel, the endogenous ITPase of M. perennis was predicted to encode for a C-terminal nuclear localization signal, which appears to be conserved among the ITPases of euphorbias but absent in other plant families. This subcellular localization is in line with the idea that nucleic acids remain protected in the nucleus, while deaminated nucleotides accumulate in the cytoplasm where they act as antiviral molecules. CONCLUSION: Three new RNA viruses infecting M. perennis are described, two of which encoding for ITPases. These enzymes have distinct origins, and are likely required by viruses to circumvent high level of cytoplasmic non-canonical nucleotides. This putative plant defense mechanism has emerged early in the evolution of euphorbias, and seems to specifically target certain groups of RNA viruses infecting perennial hosts.

Susceptibility and yield response of commercial corn hybrids to maize dwarf mosaic disease.

Maize dwarf mosaic (MDM) is one of the most important virus diseases of maize worldwide. Caused by the potyviruses maize dwarf mosaic virus (MDMV) or sugarcane mosaic virus (SCMV), MDM can cause up to 90% yield loss in susceptible hybrids. One of the most effective management strategies for MDM is growing potyvirus resistant corn varieties. However, yield impacts associated with MDM and the corresponding efficacy of genetic resistance present in modern U.S. commercial hybrid lines is uncharacterized. In this study, we evaluated the disease response of 78 commercial hybrids to MDMV and SCMV and quantified yield losses associated with infection over multiple trials. We determined that while 97% of the hybrids tested were resistant to MDMV, 100% were susceptible to SCMV, with mean disease incidence per line averaging between 45% and 78% across six trial years. Despite only one hybrid displaying visible mosaic symptoms when inoculated with MDMV, MDMV reduced average yields by approximately 5% across all hybrids compared to the mock inoculated treatment. The yield impact of SCMV was more severe, reducing average yields by 10% across replicated experiments. These results indicate that while most commercial hybrids are resistant to MDMV, possibly due to the presence of the major Scmv1 resistance locus on chromosome 6, additional potyvirus resistance genes are needed to manage SCMV induced MDM. Pyramiding resistance loci, such as Scmv2 on chromosome 3 or Scmv3 on chromosome 10 in addition to Scmv1 could be an effective strategy to mitigate the yield impact of MDM disease.

Molecular Characteristics of Bean Common Mosaic Virus Occurring in Inner Mongolia, China.

Bean common mosaic virus (BCMV) was detected on common bean (Phaseolus vulgaris) plants showing wrinkled and/or narrow leaves, curling, shrinking and chlorosis of leaves, dwarfing of plants, and mottled pods in Inner Mongolia and named BCMV-22Huhe. Its genome has a size of 10,062 bp and was deposited in GenBank under the accession number OR778613. It is closely related to BCMV-Az (GenBank accession no. KP903372, in China) in the lineage of AzBMV. A recombination event was detected for BCMV-22Huhe among the 99 BCMV isolates published in the NCBI GenBank database, showing that BCMV-CJ25 (MK069986, found in Mexico) was a potential major parent, and the minor parent is unknown. This work is the first description of the occurrence of BCMV in Inner Mongolia, China.

Intrinsic disorder in the dynamic evolution of structure, stability, and flexibility of potyviral VLP assemblies: A computational study.

An all-atom Molecular Dynamics (MD) study was applied to three viral nanoparticles (VLPs) of Turnip mosaic virus (TuMV), a potyvirus: the particles genetically functionalized with two peptides, VIP (human vasoactive intestinal peptide) and VEGFR (peptide derived from the human receptor 3 of the vascular endothelial growth factor), and the non-functionalized VLP. Previous experimental results showed that VIP-VLP was the only construct of the three that was not viable. VLPs subjected to our MD study were modeled by four complete turns of the particle involving 35 subunits of the coat protein (CP). The MD simulations showed differences in structures and interaction energies associated to the crucial contribution of the disordered N-terminal arms of CP to the global stability of the particle. These differences suggested an overall stability greater in VEGFR-VLP and smaller in VIP-VLP as compared to the unfunctionalized VLP. Our novel MD study of potyviral VLPs revealed essential clues about structure and interactions of these assembled protein particles and suggests that the computational prediction of the viability of VLPs can be a valuable contribution in the field of viral nanobiotechnology.

Characterization of a New, Country Bean (Lablab purpureus) Lineage of Bean Common Mosaic Necrosis Virus.

Country bean (Lablab purpureus, family Fabaceae) is grown in subsistence agriculture in Bangladesh as a multipurpose crop for food, animal feed, and green manure. This study was undertaken to investigate the genetic diversity of bean common mosaic necrosis virus (BCMNV, genus Potyvirus, family Potyviridae) in country beans. Leaf samples from country beans showing yellowing, vein banding, and mosaic symptoms were collected during field surveys between 2015 and 2019 cropping seasons from farmers' fields in different geographic regions. These samples were tested by serological and molecular diagnostic assays for the presence of BCMNV. Virus-positive samples were subjected to high-throughput Illumina sequencing to generate near-complete genomes of BCMNV isolates. In pairwise comparisons, the polyprotein sequences of BCMNV isolates from Bangladesh showed greater than 98% identities among themselves and shared less than 84% sequence identity at the nucleotide level with virus isolates reported from other countries. In the phylogenetic analysis, BCMNV isolates from Bangladeshi country beans formed a separate clade from virus isolates reported from common beans in other countries in the Americas, Africa, Europe, and from East Timor. Grow-out studies showed seed-to-seedling transmission of BCMNV, implying a possible seedborne nature of the virus in country beans.

Monitoring the Intracellular Trafficking of Virus-Induced Structures and Intercellular Spread of Viral Infection in Plants Using Endomembrane Trafficking Pathway-Specific Chemical Inhibitor and Organelle-Selective Fluorescence Dye.

Infection by positive-strand RNA viruses induces extensive remodeling of the host endomembrane system in favor of viral replication and movement. The integral membrane protein 6K2 of potyviruses induces the formation of membranous virus replication vesicles at the endoplasmic reticulum exit site (ERES). The intracellular trafficking of 6K2-induced vesicles along with microfilaments requires the vesicular transport pathway, actomyosin motility system, and possibly post-Golgi compartments such as endosomes as well. Recent studies have shown that endocytosis is essential for the intracellular movement of potyviruses from the site of viral genome replication/assembly site to plasmodesmata (PD) to enter neighboring cells. In this chapter, we describe a detailed protocol of how to use endomembrane trafficking pathway-specific chemical inhibitors and organelle-selective fluorescence dye to study the trafficking of potyviral proteins and potyvirus-induced vesicles and to unravel the role of endocytosis and the endocytic pathway in potyvirus infection in Nicotiana benthamiana plants.

Complete genome sequence of bean common mosaic virus from black bean in Vietnam.

This is a report of a complete genome sequence of bean common mosaic virus in Vietnam. This virus shares around 99% nucleotide identity with a Nepal isolate.

Pathogen Eradication in Garlic in the Phytobiome Context: Should We Aim for Complete Cleaning?

Global food production is challenged by plant pathogens that cause significant crop losses. Fungi, bacteria, and viruses have long threatened sustainable and profitable agriculture. The danger is even higher in vegetatively propagated horticultural crops, such as garlic. Currently, quarantine, rouging infected plants, and control of natural vectors are used as the main means of disease and pest control in garlic crops. Agricultural biotechnology, meristem-tip culture, and cryotherapy offer solutions for virus eradication and for the multiplication of 'clean stocks', but at the same time, impact the symbiotic and beneficial components of the garlic microbiome. Our research involves the first metatranscriptomic analysis of the microbiome of garlic bulb tissue, PCR analyses, and a biological assay of endophytes and pathogens. We have demonstrated that in vitro sanitation methods, such as shoot tip culture or cryotherapy can alter the garlic microbiome. Shoot tip culture proved ineffective in virus elimination, but reduced bacterial load and eliminated fungal infections. Conversely, cryotherapy was efficient in virus eradication but demolished other components of the garlic microbiome. Garlic plants sanitized by cryotherapy exhibited a lower survival rate, and a longer in vitro regeneration period. The question arises whether total eradication of viruses, at the expense of other microflora, is necessary, or if a partial reduction in the pathogenic load would suffice for sanitized garlic production. We explore this question from both scientific and commercial perspectives.

Virome Analysis of Aconitum carmichaelii Reveals Infection by Eleven Viruses, including Two Potentially New Species.

Aconitum carmichaelii is a herbaceous herb indigenous to China that has been cultivated for traditional medicine for centuries. Virus-like symptoms of A. carmichaelii plants were observed on leaves in some A. carmichaelii plantations in Zhanyi and Wuding Counties, Yunnan Province, southwest China. High-throughput sequencing (HTS) was performed on 28 symptomatic plants, and the results revealed infection with 11 viruses, including 2 novel viruses and 9 previously described viruses: Aconitum amalgavirus 1 (AcoAV-1), aconite virus A (AcVA), cucumber mosaic virus (CMV), currant latent virus (CuLV), apple stem grooving virus (ASGV), chilli veinal mottle virus (ChiVMV), tomato spotted wilt orthotospovirus (TSWV), tobacco vein distorting virus (TVDV), and potato leafroll virus (PLRV). Two novel viruses tentatively named Aconitum potyvirus 1 and Aconitum betapartitivirus 1, were supported by sequence and phylogenetic analysis results of their genomes. We proposed the names Potyvirus aconiti and Betapartitivirus aconiti. RT-PCR assays of 142 plants revealed the predominance and widespread distribution of CMV, AcVA, and AcoPV-1 in plantations. The detection of isolates of CuLV, ASGV, ChiVMV, TSWV, TVDV, and PLRV infections for the first time in A. carmichaelii expands their known host ranges.

Characterization of a Putative New Member of the Genus Potyvirus from Kudzu (Pueraria montana var. lobata) in Mississippi.

Kudzu (Pueraria montana var. lobata), a plant native to Southeastern Asia, has become a major noxious weed covering millions of hectares in the Southern United States. A kudzu patch displaying virus-like symptoms located in Ackerman, northeastern Mississippi (MS), was used as a source for virus isolation and characterization involving mechanical and vector transmission, ultrastructural observation, surveys, Sanger and high-throughput genome sequencing, and sequence analyses. The results revealed the presence of a new potyvirus in infected kudzu, closely related to wisteria vein mosaic virus (WVMV) and provisionally named kudzu chlorotic ring blotch virus (KudCRBV). Genome features and pairwise comparison with six WVMV genomes currently available in GenBank and three additional isolates from MS sequenced in this work suggest that KudCRBV is likely a member of a new species in the genus Potyvirus. Furthermore, under experimental conditions, KudCRBV was successfully transmitted by cotton and potato aphids and mechanically to soybean and beans. A state-wide survey revealed several kudzu patches infected by the virus in northern MS.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

The Temporal and Geographical Dynamics of Potato Virus Y Diversity in Russia.

Potato virus Y, an important viral pathogen of potato, has several genetic variants and geographic distributions which could be affected by environmental factors, aphid vectors, and reservoir plants. PVY is transmitted to virus-free potato plants by aphids and passed on to the next vegetative generations through tubers, but the effects of tuber transmission in PVY is largely unknown. By using high-throughput sequencing, we investigated PVY populations transmitted to potato plants by aphids in different climate zones of Russia, namely the Moscow and Astrakhan regions. We analyzed sprouts from the tubers produced by field-infected plants to investigate the impact of tuber transmission on PVY genetics. We found a significantly higher diversity of PVY isolates in the Astrakhan region, where winters are shorter and milder and summers are warmer compared to the Moscow region. While five PVY types, NTNa, NTNb, N:O, N-Wi, and SYR-I, were present in both regions, SYRI-II, SYRI-III, and 261-4 were only found in the Astrakhan region. All these recombinants were composed of the genome sections derived from PVY types O and N, but no full-length sequences of such types were present. The composition of the PVY variants in the tuber sprouts was not always the same as in their parental plants, suggesting that tuber transmission impacts PVY genetics.